Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03267

HP ID(1) HP03267
Gene ID(2) 92840
Gene Symbol finder REEP6
Protein Name receptor accessory protein 6
RefSeq NM_138393.1
Length of RefSeq (bp) 1393
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.76277

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb53F10 pGCAP1 GGCGGGAAAGCGGATGCGCGATGCAGCGGGGATGGGTTGCCCTTGCGCTCNGCGGGCGAG
RBd31H03 pGCAP10 GAGGCTGCGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGTCCGCGGGCGAGCT
RBd36D10 pGCAP10 GAGCATCGCGGCTCAGGCTGCGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGT
RBd93G03 pGCAP10 GGCCCTGGTCCGCGGGCGAGCTCGAGCAGCCAACCCCGGGCGCGTCGGGGCCATGGACGG
RBdS022L02 pGCAP10 GGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGTCCGCGGGCGAGCTCGAGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl