Prev. |  KEGG KO K17279 > 

RIKEN DNA Bank Human Resource - REEP6

Gene ID NCBI Gene 92840 |  KEGG hsa:92840
Gene Symbol REEP6
Protein Name receptor accessory protein 6
Synonyms C19orf32|DP1L1|REEP6.1|REEP6.2|RP77|TB2L1|Yip2f
Ortholog resources KEGG ortholog (KEGG orthology K17279) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005303 IRAK013E07 pCMV-SPORT6 BC008201 NM_138393

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR341330 RBb53F10 pGCAP1 NM_138393.1  
GGCGGGAAAGCGGATGCGCGATGCAGCGGGGATGGGTTGCCCTTGCGCTCNGCGGGCGAG
HKR372571 RBd31H03 pGCAP10 NM_138393.1  
GAGGCTGCGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGTCCGCGGGCGAGCT
HKR374482 RBd36D10 pGCAP10 NM_138393.1  
GAGCATCGCGGCTCAGGCTGCGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGT
HKR397347 RBd93G03 pGCAP10 NM_138393.1  
GGCCCTGGTCCGCGGGCGAGCTCGAGCAGCCAACCCCGGGCGCGTCGGGGCCATGGACGG
HKR409066 RBdS022L02 pGCAP10 NM_138393.1  
GGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGTCCGCGGGCGAGCTCGAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl