Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022L02

Clone ID RBdS022L02
HP ID HP03267
Gene ID 92840
Gene Symbol REEP6
Protein Name receptor accessory protein 6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138393.1
Length of RefSeq (bp) 1393
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.76277
5'-terminal sequence GGGGAAAGCGGTGCGCGTGCAGCGGGGTGGGTGCCCTGGTCCGCGGGCGAGCTCGAGCAG
2011.08.28