Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03071

HP ID(1) HP03071
Gene ID(2) 5984
Gene Symbol finder RFC4
Protein Name replication factor C (activator 1) 4, 37kDa
RefSeq NM_002916.3
Length of RefSeq (bp) 1427
Chromosome 3q27
Reference DDBJ accession
UniGene Hs.714318

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013J15 pGCAP10 GGTTCCGTGGCGGGAACTGAGGCGACTGTGGGGACATCAGTGATNGNNNNTCTCCTGGGC
RBd43H07 pGCAP10 GGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCAGATTA
RBd99D04 pGCAP10 TAATTGGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCA
RBdS022L13 pGCAP10 GGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCAGATTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl