Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022L13

Clone ID RBdS022L13
HP ID HP03071
Gene ID 5984
Gene Symbol RFC4
Protein Name replication factor C (activator 1) 4, 37kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002916.3
Length of RefSeq (bp) 1427
Chromosome 3q27
Reference DDBJ accession
UniGene Hs.714318
5'-terminal sequence GGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCAGATTA
2011.08.28