Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RFC4

Gene ID (NCBI) 5984
Gene Symbol RFC4
Protein Name replication factor C (activator 1) 4, 37kDa
Synonyms A1|RFC37
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083481 IRAL008L17 pOTB7 BC017452 NM_181573 Full
HGY095326 IRAL038F06 pDNR-LIB BC024022 NM_181573 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE006045 W01A015B21 pENTR-TOPO IRAL038F06 BC024022 NM_181573
HGE006047 W01A015B23 pENTR-TOPO IRAL038F06 BC024022 NM_181573
HGE006083 W01A015D11 pENTR-TOPO IRAL008L17 BC017452 NM_181573
HGE006087 W01A015D15 pENTR-TOPO IRAL008L17 BC017452 NM_181573

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR205431 ARiS013J15 pGCAP10 NM_002916.3
GGTTCCGTGGCGGGAACTGAGGCGACTGTGGGGACATCAGTGATNGNNNNTCTCCTGGGC
HKR377375 RBd43H07 pGCAP10 NM_002916.3
GGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCAGATTA
HKR399676 RBd99D04 pGCAP10 NM_002916.3
TAATTGGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCA
HKR409077 RBdS022L13 pGCAP10 NM_002916.3
GGAGGCGACTGTGGGGACATCAGTGATCGTAAGTCTCCTGGGCCCGTTATTCTCAGATTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl