Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03066

HP ID(1) HP03066
Gene ID(2) 5873
Gene Symbol finder RAB27A
Protein Name RAB27A, member RAS oncogene family
RefSeq NM_004580.3
Length of RefSeq (bp) 2824
Chromosome 15q15-q21.1
Reference DDBJ accession
UniGene Hs.654978

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi34A01 pGCAP10 GGTGTGATTCAAGACACAGGAAGAGAAGTGGGTTTGAAGCAAGGTTGTGGAGAAAAGCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl