Prev. |  Human A to Z list >  R >  RAB27A > 

ARi34A01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR173601
Clone Name ARi34A01
Clone info. Plasmid clone of human RAB27A cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGTGTGATTCAAGACACAGGAAGAGAAGTGGGTTTGAAGCAAGGTTGTGGAGAAAAGCAA
Sequence, submitted(2) n.a.
Note Covering 109 to 918nt of NM_004580.4 (CDS, 305-1909).
 
Sequence, refered NM_004580.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RAB27A (NCBI Gene 5873)  other clone of RAB27A in our bank
Synonyms GS2|HsT18676|RAB27|RAM
Protein Name RAB27A, member RAS oncogene family
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR173601 ARi34A01 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARi34A01a.seq   ARi34A01c.seq   ARi34A01.pdf

References and tips

Featured content

Reference


2018.12.21

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_181121.pl