ARi34A01 NRCD Human cDNA Clone

Prev. | Human A to Z list > R > RAB27A >

ARi34A01 - NRCD Human cDNA Clone


Catalog Number	HKR173601
Clone Name	ARi34A01
Clone info.	Plasmid clone of human RAB27A cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GGTGTGATTCAAGACACAGGAAGAGAAGTGGGTTTGAAGCAAGGTTGTGGAGAAAAGCAA
Sequence, submitted⁽³⁾	n.a.
Note	Covering 109 to 918nt of NM_004580.4 (CDS, 305-1909).
Sequence, refered	NM_004580.3 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	RAB27A (NCBI Gene 5873) other clone of RAB27A in our bank
Synonyms	GS2\|HsT18676\|RAB27\|RAM
Protein Name	RAB27A, member RAS oncogene family

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR173601	ARi34A01	DNA solution

How to cite this biological resource

Materials & Methods section:

The ARi34A01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR173601).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (by primer A)	Seq File (by primer B)	Seq File (by primer C)	Seq File (contig)	PDF File
ARi34A01a.seq		ARi34A01c.seq		ARi34A01.pdf