RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - RAB27A

Gene ID	NCBI Gene 5873 \| KEGG hsa:5873
Gene Symbol	RAB27A
Protein Name	RAB27A, member RAS oncogene family
Synonyms	GS2\|HsT18676\|RAB27\|RAM
Featured content	Rab Family - human

Ortholog resource in our bank

  RAB27A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB18647	pMRX-bsr-EGFP-hRab27A	Retroviral expression vector of human Rab27A.
RDB18648	pMRX-bsr-EGFP-hRab27A-V143A	Retroviral expression vector of human Rab27A with a mutation (V143A) that disrupts Munc13-4 binding.

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR173601	ARi34A01	pGCAP10	NM_004580.3
HKR173601	GGTGTGATTCAAGACACAGGAAGAGAAGTGGGTTTGAAGCAAGGTTGTGGAGAAAAGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl