Prev. |  KEGG KO K07885 > 

RIKEN DNA Bank Human Resource - RAB27A

Gene ID NCBI Gene 5873 |  KEGG hsa:5873
Gene Symbol RAB27A
Protein Name RAB27A, member RAS oncogene family
Synonyms GS2|HsT18676|RAB27|RAM
Featured content Rab Family - human
Ortholog resource in our bank

  RAB27A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18647 pMRX-bsr-EGFP-hRab27A Retroviral expression vector of human Rab27A.
RDB18648 pMRX-bsr-EGFP-hRab27A-V143A Retroviral expression vector of human Rab27A with a mutation (V143A) that disrupts Munc13-4 binding.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173601 ARi34A01 pGCAP10 NM_004580.3 done
GGTGTGATTCAAGACACAGGAAGAGAAGTGGGTTTGAAGCAAGGTTGTGGAGAAAAGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.07.13

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl