Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02076

HP ID(1) HP02076
Gene ID(2) 390
Gene Symbol finder RND3
Protein Name Rho family GTPase 3
RefSeq NM_005168.3
Length of RefSeq (bp) 2683
Chromosome 2q23.3
Reference DDBJ accession
UniGene Hs.6838

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46G12 pKA1U5 GTCCTCTCATTGAGAAAGAAGAGGATTGGAAGGCCGGGCGTATAAAGCCGCGCAGAGAGC
ARi08B10 pGCAP10 GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
ARi63H01 pGCAP10 GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
ARiS198H16 pGCAP10 GGCAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTT
RBdS081L10 pGCAP10 GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
RBdS105N04 pGCAP10 GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl