Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RND3

Gene ID (NCBI) 390
Gene Symbol RND3
Protein Name Rho family GTPase 3
Synonyms ARHE|Rho8|RhoE|memB
Databases KEGG hsa:390 |  NCBI Gene 390
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07859)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163234 ARi08B10 pGCAP10 NM_005168.3  
GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
HKR058556 ARe46G12 pKA1U5 NM_005168.3  
GTCCTCTCATTGAGAAAGAAGAGGATTGGAAGGCCGGGCGTATAAAGCCGCGCAGAGAGC
HKR185369 ARi63H01 pGCAP10 NM_005168.3  
GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
HKR279384 ARiS198H16 pGCAP10 NM_005168.3  
GGCAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTT
HKR432674 RBdS081L10 pGCAP10 NM_005168.3  
GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
HKR442316 RBdS105N04 pGCAP10 NM_005168.3  
GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl