Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105N04

Clone ID RBdS105N04
HP ID HP02076
Gene ID 390
Gene Symbol RND3
Protein Name Rho family GTPase 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005168.3
Length of RefSeq (bp) 2683
Chromosome 2q23.3
Reference DDBJ accession
UniGene Hs.6838
5'-terminal sequence GAGTCGGCTCGGAATTGGACTTGGGAGGCGCGGTGAGGAGTCAGGCTTAAAACTTGTTGG
2011.08.28