Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02057

HP ID(1) HP02057
Gene ID(2) 9978
Gene Symbol finder RBX1
Protein Name ring-box 1
RefSeq NM_014248.2
Length of RefSeq (bp) 521
Chromosome 22q13.2
Reference DDBJ accession
UniGene Hs.474949

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23B07 pKA1U5 GAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAA
ARe80H05 pKA1U5 GGACAGACCGTGNTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCA
ARe82E02 pKA1U5 GGTGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAG
ARi10C06 pGCAP10 GGTGTTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGG
ARi44E10 pGCAP10 GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
ARi48D06 pGCAP10 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTGTTTCTGTAGCCATATTGTATTCTGTG
ARiS008A24 pGCAP10 GGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCAC
ARiS194C02 pGCAP10 GGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGGC
RBb14G01 pKA1U5 GGACAGACCGCTGATGTTTCCAAAATGGCGGCAGCCATNGATGTGGATACCCCGAGCGGC
RBb23A11 pGCAP1 GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
RBb58G03 pGCAP1 GGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTTGGATACCCCGAGCGGCA
RBb58H03 pGCAP1 GGACAGAACCGTTGNTGNTTTCCAAAATGGCGGCAGCGGATGGATGTGGATACCCCGAGC
RBd11E03 pGCAP10 GTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGG
RBdS013H01 pGCAP10 GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
RBdS015D12 pGCAP10 GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
RBdS104G23 pGCAP10 GGGACGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCG
RBdS104I02 pGCAP10 GAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAA
RBdS177G12 pGCAP10 GGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl