Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104G23

Clone ID RBdS104G23
HP ID HP02057
Gene ID 9978
Gene Symbol RBX1
Protein Name ring-box 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014248.2
Length of RefSeq (bp) 521
Chromosome 22q13.2
Reference DDBJ accession
UniGene Hs.474949
5'-terminal sequence GGGACGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCG
2011.08.28