Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RBX1

Gene ID (NCBI) 9978
Gene Symbol RBX1
Protein Name ring-box 1, E3 ubiquitin protein ligase
Synonyms BA554C12.1|RNF75|ROC1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Circadian clock (human)
Featured content DNA repair (human)
Featured content Wnt signaling pathway (human)
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081831 IRAL004J15 pOTB7 BC001466 NM_014248 Full
HGY087665 IRAL019C17 pDNR-LIB BC017370 NM_014248 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE044984 W01A112H16 pENTR-TOPO IRAL004J15 BC001466 NM_014248  
HGE044988 W01A112H20 pENTR-TOPO IRAL004J15 BC001466 NM_014248  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164054 ARi10C06 pGCAP10 NM_014248.2  
GGTGTTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGG
HKR049231 ARe23B07 pKA1U5 NM_014248.2  
GAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAA
HKR177706 ARi44E10 pGCAP10 NM_014248.2  
GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
HKR179278 ARi48D06 pGCAP10 NM_014248.2  
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTGTTTCTGTAGCCATATTGTATTCTGTG
HKR072173 ARe80H05 pKA1U5 NM_014248.2  
GGACAGACCGTGNTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCA
HKR072898 ARe82E02 pKA1U5 NM_014248.2  
GGTGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAG
HKR203224 ARiS008A24 pGCAP10 NM_014248.2  
GGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCAC
HKR277650 ARiS194C02 pGCAP10 NM_014248.2  
GGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGGC
HKR325745 RBb14G01 pKA1U5 NM_014248.2  
GGACAGACCGCTGATGTTTCCAAAATGGCGGCAGCCATNGATGTGGATACCCCGAGCGGC
HKR364499 RBd11E03 pGCAP10 NM_014248.2  
GTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCGG
HKR329211 RBb23A11 pGCAP1 NM_014248.2  
GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
HKR343347 RBb58G03 pGCAP1 NM_014248.2  
GGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTTGGATACCCCGAGCGGCA
HKR343371 RBb58H03 pGCAP1 NM_014248.2  
GGACAGAACCGTTGNTGNTTTCCAAAATGGCGGCAGCGGATGGATGTGGATACCCCGAGC
HKR405369 RBdS013H01 pGCAP10 NM_014248.2  
GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
HKR406084 RBdS015D12 pGCAP10 NM_014248.2  
GGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAACAGCG
HKR441767 RBdS104G23 pGCAP10 NM_014248.2  
GGGACGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCG
HKR441794 RBdS104I02 pGCAP10 NM_014248.2  
GAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCACCAA
HKR470956 RBdS177G12 pGCAP10 NM_014248.2  
GGACAGACCGTGTGTTTCCAAAATGGCGGCAGCGATGGATGTGGATACCCCGAGCGGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl