Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01647

HP ID(1) HP01647
Gene ID(2) 27316
Gene Symbol finder RBMX
Protein Name RNA binding motif protein, X-linked
RefSeq NM_002139.2
Length of RefSeq (bp) 2078
Chromosome Xq26.3
Reference DDBJ accession
UniGene Hs.380118

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe54G09 pKA1U5 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
ARe82C07 pKA1U5 GGTCCTTCAGCCTCGTTCCCGGGCAGTATAAAGTTTGCTGTCTCCTTTGTTCGCCCTCGT
ARi17G05 pGCAP10 GCTCGTTGCGCAGTAGTACTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
ARi54H05 pGCAP10 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
ARiS023E03 pGCAP10 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
RBb05D04 pKA1U5 GTCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCC
RBb40F11 pGCAP1 AGGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACT
RBb43A03 pGCAP1 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
RBb59H07 pGCAP1 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
RBb64F02 pGCAP1 GGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTG
RBd20H01 pGCAP10 GGGGACTCGAGCCTAGGGAGGCGAGGTTCCCGCACCGGATAGCATGTTTTTGGCCCAGAG
RBd24B12 pGCAP10 GGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTG
RBd27H11 pGCAP10 TTGGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCAC
RBd51A05 pGCAP10 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
RBd64G12 pGCAP10 GAGTCGGGACTCGAGCCTAGGGAGGCGAGGTTCCCGCACCGGATAGGAACATTCTGTTGT
RBdS007J02 pGCAP10 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
RBdS022F17 pGCAP10 GCTCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGC
RBdS040G05 pGCAP10 GGTTCGCCCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCA
RBdS051P07 pGCAP10 GGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTG
RBdS132K05 pGCAP10 GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl