Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022F17

Clone ID RBdS022F17
HP ID HP01647
Gene ID 27316
Gene Symbol RBMX
Protein Name RNA binding motif protein, X-linked
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002139.2
Length of RefSeq (bp) 2078
Chromosome Xq26.3
Reference DDBJ accession
UniGene Hs.380118
5'-terminal sequence GCTCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGC
2011.08.28