Prev. |  KEGG KO K12885 > 

RIKEN DNA Bank Human Resource - RBMX

Gene ID NCBI Gene 27316 |  KEGG hsa:27316
Gene Symbol RBMX
Protein Name RNA binding motif protein X-linked
Synonyms HNRNPG|HNRPG|MRXS11|RBMXP1|RBMXRT|RNMX|hnRNP-G
Ortholog resources KEGG ortholog (KEGG orthology K12885) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081274 IRAL003D02 pOTB7 BC006550 NM_002139 Full
HGY084018 IRAL010A18 pOTB7 BC007435 NM_002139 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001612 W01A004A12 pENTR-TOPO IRAL003D02 BC007435 NM_002139  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061753 ARe54G09 pKA1U5 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR072855 ARe82C07 pKA1U5 NM_002139.2  
GGTCCTTCAGCCTCGTTCCCGGGCAGTATAAAGTTTGCTGTCTCCTTTGTTCGCCCTCGT
HKR166949 ARi17G05 pGCAP10 NM_002139.2  
GCTCGTTGCGCAGTAGTACTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR181773 ARi54H05 pGCAP10 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR209299 ARiS023E03 pGCAP10 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR322076 RBb05D04 pKA1U5 NM_002139.2  
GTCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCC
HKR336131 RBb40F11 pGCAP1 NM_002139.2  
AGGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACT
HKR337203 RBb43A03 pGCAP1 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR343775 RBb59H07 pGCAP1 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR345722 RBb64F02 pGCAP1 NM_002139.2  
GGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTG
HKR368169 RBd20H01 pGCAP10 NM_002139.2  
GGGGACTCGAGCCTAGGGAGGCGAGGTTCCCGCACCGGATAGCATGTTTTTGGCCCAGAG
HKR369636 RBd24B12 pGCAP10 NM_002139.2  
GGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTG
HKR370979 RBd27H11 pGCAP10 NM_002139.2  
TTGGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCAC
HKR380405 RBd51A05 pGCAP10 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR385756 RBd64G12 pGCAP10 NM_002139.2  
GAGTCGGGACTCGAGCCTAGGGAGGCGAGGTTCCCGCACCGGATAGGAACATTCTGTTGT
HKR403018 RBdS007J02 pGCAP10 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA
HKR408937 RBdS022F17 pGCAP10 NM_002139.2  
GCTCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGC
HKR416149 RBdS040G05 pGCAP10 NM_002139.2  
GGTTCGCCCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCA
HKR420767 RBdS051P07 pGCAP10 NM_002139.2  
GGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTG
HKR453045 RBdS132K05 pGCAP10 NM_002139.2  
GCTCGTTGCGCAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl