Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01597

HP ID(1) HP01597
Gene ID(2) 51596
Gene Symbol finder CUTA
Protein Name cutA divalent cation tolerance homolog (E. coli)
RefSeq NM_015921.2
Length of RefSeq (bp) 1214
Chromosome 6pter-p21.31
Reference DDBJ accession
UniGene Hs.520070

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe50F12 pKA1U5 GATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGCGCTGT
ARe96C05 pKA1U5 GANAGGCCGCTCTTCCTNGGGTTGTTTCTCCGGTGTGACGGTGNGATCTTTGTANATCAA
ARf03F03 pKA1U5 GCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCC
ARf04E11 pKA1U5 GGGGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGCGC
ARi26D01 pGCAP10 GGGCGGAGTGGTGAGTGACCGGCCCCGCCCCGCCCCTTCCGGTCCTCGAAGCCTCGACCG
ARi43G08 pGCAP10 GCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCC
ARi54D12 pGCAP10 GGTCCTTCTTCTACTGTCACATGGTGCGCGCTGTTTCCTAATCACGTGGCTGCCACCCAG
ARi71A04 pGCAP10 GAATCACGTGGCTGCCACCCAGGTAAGAAGAGGCCGCTCTTCCTGGGGTTGTTTCTCCGT
ARiS008I02 pGCAP10 GGGTGCGCGCTGTTTTCTAATCACGTGGCTGCCACCCAGGCCTCTCTGCTCCTGTCTTTT
ARiS020J07 pGCAP10 CCGGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGCGCTGTT
ARiS023H16 pGCAP10 GAAATCCCAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCA
ARiS122L08 pGCAP10 GAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCAAGTTTCT
RBb02A02 pKA1U5 GCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCCCTGAGGTGT
RBb16C01 pKA1U5 ATCCTGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGC
RBb54F09 pGCAP1 GACCCCGCACCCTAAATCCCAGAGGTTGGCCCCCTGTAGGTGTGAGTGAAATGAGCTTTT
RBd02E04 pGCAP10 GGTTTCTCCGTGTGACGTGTGGCCTTTGAGATCAACTCTCCTGTACCAGCGTAGGCCGCA
RBd04B08 pGCAP10 GCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCAAGTTTCTCTCTCACCTTCAG
RBd85D03 pGCAP10 TGGCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCCCT
RBd93G01 pGCAP10 GGCTGCCACCCAGGTAAGAAGAGGCCGCTCTTCCTGGGGTTGTTTCTCCGTGTGACGTGT
RBd98E04 pGCAP10
RBdS022E07 pGCAP10 TGGATGATAGGGCCGGGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTC
RBdS104C02 pGCAP10 GAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCCCTGAGGTGTGAGTGA
RBdS154H20 pGCAP10 GCCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCC
RBdS156A09 pGCAP10 GGCTGTTTTCTAATCACGTGGCTGCCACCCAGGGGCATTCTTCGGGGGTGCATCAGAGGG
RBdS187E23 pGCAP10 GAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCAAGTTTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl