Prev. |  Human A to Z list >  C >  CUTA > 

ARi54D12 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR181684
Clone Name ARi54D12
Clone info. Plasmid clone of human CUTA cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGTCCTTCTTCTACTGTCACATGGTGCGCGCTGTTTCCTAATCACGTGGCTGCCACCCAG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_015921.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CUTA (NCBI Gene 51596)  other clone of CUTA in our bank
Synonyms ACHAP|C6orf82
Protein Name cutA divalent cation tolerance homolog
KEGG hsa:51596
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR181684 ARi54D12 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.20

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl