Prev. |  KEGG KO K03926 > 

RIKEN DNA Bank Human Resource - CUTA

Gene ID NCBI Gene 51596 |  KEGG hsa:51596
Gene Symbol CUTA
Protein Name cutA divalent cation tolerance homolog
Synonyms ACHAP|C6orf82
Ortholog resources KEGG ortholog (KEGG orthology K03926) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082929 IRAL007F09 pOTB7 BC005890 NM_015921 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR060132 ARe50F12 pKA1U5 NM_015921.2  
GATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGCGCTGT
HKR078453 ARe96C05 pKA1U5 NM_015921.2  
GANAGGCCGCTCTTCCTNGGGTTGTTTCTCCGGTGTGACGGTGNGATCTTTGTANATCAA
HKR081323 ARf03F03 pKA1U5 NM_015921.2  
GCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCC
HKR081707 ARf04E11 pKA1U5 NM_015921.2  
GGGGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGCGC
HKR170473 ARi26D01 pGCAP10 NM_015921.2  
GGGCGGAGTGGTGAGTGACCGGCCCCGCCCCGCCCCTTCCGGTCCTCGAAGCCTCGACCG
HKR177352 ARi43G08 pGCAP10 NM_015921.2  
GCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCC
HKR181684 ARi54D12 pGCAP10 NM_015921.2  
GGTCCTTCTTCTACTGTCACATGGTGCGCGCTGTTTCCTAATCACGTGGCTGCCACCCAG
HKR188404 ARi71A04 pGCAP10 NM_015921.2  
GAATCACGTGGCTGCCACCCAGGTAAGAAGAGGCCGCTCTTCCTGGGGTTGTTTCTCCGT
HKR203394 ARiS008I02 pGCAP10 NM_015921.2  
GGGTGCGCGCTGTTTTCTAATCACGTGGCTGCCACCCAGGCCTCTCTGCTCCTGTCTTTT
HKR208223 ARiS020J07 pGCAP10 NM_015921.2  
CCGGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGCGCTGTT
HKR209384 ARiS023H16 pGCAP10 NM_015921.2  
GAAATCCCAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCA
HKR249072 ARiS122L08 pGCAP10 NM_015921.2  
GAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCAAGTTTCT
HKR320802 RBb02A02 pKA1U5 NM_015921.2  
GCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCCCTGAGGTGT
HKR326449 RBb16C01 pKA1U5 NM_015921.2  
ATCCTGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACATGGTGCGC
HKR341729 RBb54F09 pGCAP1 NM_015921.2  
GACCCCGCACCCTAAATCCCAGAGGTTGGCCCCCTGTAGGTGTGAGTGAAATGAGCTTTT
HKR360900 RBd02E04 pGCAP10 NM_015921.2  
GGTTTCTCCGTGTGACGTGTGGCCTTTGAGATCAACTCTCCTGTACCAGCGTAGGCCGCA
HKR361632 RBd04B08 pGCAP10 NM_015921.2  
GCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCAAGTTTCTCTCTCACCTTCAG
HKR394075 RBd85D03 pGCAP10 NM_015921.2  
TGGCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCCCT
HKR397345 RBd93G01 pGCAP10 NM_015921.2  
GGCTGCCACCCAGGTAAGAAGAGGCCGCTCTTCCTGGGGTTGTTTCTCCGTGTGACGTGT
HKR399300 RBd98E04 pGCAP10 NM_015921.2  
HKR408903 RBdS022E07 pGCAP10 NM_015921.2  
TGGATGATAGGGCCGGGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTC
HKR441650 RBdS104C02 pGCAP10 NM_015921.2  
GAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCCCCTGAGGTGTGAGTGA
HKR461788 RBdS154H20 pGCAP10 NM_015921.2  
GCCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCC
HKR462409 RBdS156A09 pGCAP10 NM_015921.2  
GGCTGTTTTCTAATCACGTGGCTGCCACCCAGGGGCATTCTTCGGGGGTGCATCAGAGGG
HKR474919 RBdS187E23 pGCAP10 NM_015921.2  
GAGAGGTTGGCCCCCTGAGGTGTGAGTGAAATGAGCTTTTGCTTTATTTTCCAAGTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl