Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154H20

Clone ID RBdS154H20
HP ID HP01597
Gene ID 51596
Gene Symbol CUTA
Protein Name cutA divalent cation tolerance homolog (E. coli)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015921.2
Length of RefSeq (bp) 1214
Chromosome 6pter-p21.31
Reference DDBJ accession
UniGene Hs.520070
5'-terminal sequence GCCCTTCCGGTCCTCGAAGCCTCGACCGCTACCCGCACCCTAAATCCCAGAGGTTGGCCC
2011.08.28