Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01398

HP ID(1) HP01398
Gene ID(2) 9939
Gene Symbol finder RBM8A
Protein Name RNA binding motif protein 8A
RefSeq NM_005105.2
Length of RefSeq (bp) 2787
Chromosome 1q12
Reference DDBJ accession
UniGene Hs.356873

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18E04 pKA1U5 TTGACAGACAAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCT
ARe62D01 pKA1U5 ATCCTGGAGTTTTCCCGAGGTACCTAGTGTCTGAGCGGCACAGACAAGATCTCGATCGAA
ARe67H02 pKA1U5 TTTTTTTCCCGAGGTACCTAGTGTCTGAGCGCCACTTACGAGATCTCGATCGAAGGCGAG
ARiS088C12 pGCAP10 GACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTGG
RBb25E05 pGCAP1 TTGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGG
RBb31F05 pGCAP1 GAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGAT
RBd47H03 pGCAP10 GACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTGG
RBd87C02 pGCAP10 GGACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTG
RBdS007M22 pGCAP10 TTGAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAG
RBdS040L21 pGCAP10 TTGAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAG
RBdS187N03 pGCAP10 GACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl