Prev. |  KEGG KO K12876 > 

RIKEN DNA Bank Human Resource - RBM8A

Gene ID NCBI Gene 9939 |  KEGG hsa:9939
Gene Symbol RBM8A
Protein Name RNA binding motif protein 8A
Synonyms BOV-1A|BOV-1B|BOV-1C|C1DELq21.1|DEL1q21.1|MDS014|RBM8|RBM8B|TAR|Y14|ZNRP|ZRNP1
Ortholog resources KEGG ortholog (KEGG orthology K12876) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008270 IRAK020L06 pCMV-SPORT6 BC017088 NM_005105 Full
HGY067130 IRAK167N18 pBluescriptR BC071577 NM_005105 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004170 W01A010H02 pENTR-TOPO IRAK020L06 BC017088 NM_005105  
HGE004174 W01A010H06 pENTR-TOPO IRAK020L06 BC017088 NM_005105  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047300 ARe18E04 pKA1U5 NM_005105.2  
TTGACAGACAAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCT
HKR064873 ARe62D01 pKA1U5 NM_005105.2  
ATCCTGGAGTTTTCCCGAGGTACCTAGTGTCTGAGCGGCACAGACAAGATCTCGATCGAA
HKR066970 ARe67H02 pKA1U5 NM_005105.2  
TTTTTTTCCCGAGGTACCTAGTGTCTGAGCGCCACTTACGAGATCTCGATCGAAGGCGAG
HKR235260 ARiS088C12 pGCAP10 NM_005105.2  
GACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTGG
HKR330101 RBb25E05 pGCAP1 NM_005105.2  
TTGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGG
HKR332525 RBb31F05 pGCAP1 NM_005105.2  
GAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGAT
HKR378971 RBd47H03 pGCAP10 NM_005105.2  
GACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTGG
HKR394850 RBd87C02 pGCAP10 NM_005105.2  
GGACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTG
HKR403110 RBdS007M22 pGCAP10 NM_005105.2  
TTGAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAG
HKR416285 RBdS040L21 pGCAP10 NM_005105.2  
TTGAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAG
HKR475115 RBdS187N03 pGCAP10 NM_005105.2  
GACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAGATCTTCACGAGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl