Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040L21

Clone ID RBdS040L21
HP ID HP01398
Gene ID 9939
Gene Symbol RBM8A
Protein Name RNA binding motif protein 8A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005105.2
Length of RefSeq (bp) 2787
Chromosome 1q12
Reference DDBJ accession
UniGene Hs.356873
5'-terminal sequence TTGAGTGTCTGAGCGGCACAGACGAGATCTCGATCGAAGGCGAGATGGCGGACGTGCTAG
2011.08.28