Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01389

HP ID(1) HP01389
Gene ID(2) 6166
Gene Symbol finder RPL36AL
Protein Name ribosomal protein L36a-like
RefSeq NM_001001.3
Length of RefSeq (bp) 549
Chromosome 14q21
Reference DDBJ accession
UniGene Hs.444749

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe29E01 pKA1U5 AAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCATCATATAGACAAAACAGCCCTGCTG
ARe32A05 pKA1U5 GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
ARe43C01 pKA1U5 TGGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGCTTTCTCGTTTTCATCATATAGACAA
ARe68F01 pKA1U5 GCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGG
ARe83B08 pKA1U5 GCTCTTTCTTCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCA
ARe87C11 pKA1U5 GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
ARe90A07 pKA1U5 GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
ARe95E11 pKA1U5 GCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGC
ARi63C02 pGCAP10 GGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCATCATATAGACAAAA
ARiS008G21 pGCAP10 GAGGCGAGAGCTGCNNAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
ARiS013D09 pGCAP10 CTCTTTCTTCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAG
ARiS013E24 pGCAP10 GCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGT
ARiS055O05 pGCAP10 GAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCAT
ARiS085O01 pGCAP10
ARiS118H15 pGCAP10 GCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCG
RBb01C03 pKA1U5 GAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTC
RBb26C10 pGCAP1 GGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTC
RBb33A07 pGCAP1 GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
RBb37D05 pGCAP1 GCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGC
RBb50E07 pGCAP1 TGGCCTTTCCTGGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCG
RBb65H08 pGCAP1 GAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCATCATATAGAC
RBd19F08 pGCAP10 GCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCG
RBd59G10 pGCAP10 GCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGT
RBd77G01 pGCAP10 GAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCAT
RBd84E03 pGCAP10 GCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGG
RBdS022D19 pGCAP10 GGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTC
RBdS083F08 pGCAP10 GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
RBdS110N11 pGCAP10 GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl