Prev. |  KEGG KO K02929 > 

RIKEN DNA Bank Human Resource - RPL36AL

Gene ID NCBI Gene 6166 |  KEGG hsa:6166
Gene Symbol RPL36AL
Protein Name ribosomal protein L36a like
Synonyms RPL36A
Ortholog resources KEGG ortholog (KEGG orthology K02929) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083054 IRAL007K14 pOTB7 BC000741 NM_001001 Full
HGY083740 IRAL009F20 pOTB7 BC003145 NM_001001 Full
HGY102831 IRAL057B07 pDNR-LIB BC070207 NM_001001 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051697 ARe29E01 pKA1U5 NM_001001.3  
AAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCATCATATAGACAAAACAGCCCTGCTG
HKR052805 ARe32A05 pKA1U5 NM_001001.3  
GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
HKR057249 ARe43C01 pKA1U5 NM_001001.3  
TGGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGCTTTCTCGTTTTCATCATATAGACAA
HKR067321 ARe68F01 pKA1U5 NM_001001.3  
GCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGG
HKR073232 ARe83B08 pKA1U5 NM_001001.3  
GCTCTTTCTTCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCA
HKR074859 ARe87C11 pKA1U5 NM_001001.3  
GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
HKR076007 ARe90A07 pKA1U5 NM_001001.3  
GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
HKR078107 ARe95E11 pKA1U5 NM_001001.3  
GCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGC
HKR185250 ARi63C02 pGCAP10 NM_001001.3  
GGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCATCATATAGACAAAA
HKR203365 ARiS008G21 pGCAP10 NM_001001.3  
GAGGCGAGAGCTGCNNAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
HKR205281 ARiS013D09 pGCAP10 NM_001001.3  
CTCTTTCTTCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAG
HKR205320 ARiS013E24 pGCAP10 NM_001001.3  
GCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGT
HKR222341 ARiS055O05 pGCAP10 NM_001001.3  
GAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCAT
HKR234337 ARiS085O01 pGCAP10 NM_001001.3  
HKR247383 ARiS118H15 pGCAP10 NM_001001.3  
GCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCG
HKR320451 RBb01C03 pKA1U5 NM_001001.3  
GAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTC
HKR330458 RBb26C10 pGCAP1 NM_001001.3  
GGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTC
HKR333207 RBb33A07 pGCAP1 NM_001001.3  
GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
HKR334877 RBb37D05 pGCAP1 NM_001001.3  
GCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGC
HKR340103 RBb50E07 pGCAP1 NM_001001.3  
TGGCCTTTCCTGGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCG
HKR346176 RBb65H08 pGCAP1 NM_001001.3  
GAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCATCATATAGAC
HKR367728 RBd19F08 pGCAP10 NM_001001.3  
GCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCG
HKR383754 RBd59G10 pGCAP10 NM_001001.3  
GCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGT
HKR390945 RBd77G01 pGCAP10 NM_001001.3  
GAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCGTTTTCAT
HKR393699 RBd84E03 pGCAP10 NM_001001.3  
GCCCTTTCCTGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGG
HKR408891 RBdS022D19 pGCAP10 NM_001001.3  
GGTTAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTC
HKR433328 RBdS083F08 pGCAP10 NM_001001.3  
GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
HKR444323 RBdS110N11 pGCAP10 NM_001001.3  
GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl