Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083F08

Clone ID RBdS083F08
HP ID HP01389
Gene ID 6166
Gene Symbol RPL36AL
Protein Name ribosomal protein L36a-like
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001001.3
Length of RefSeq (bp) 549
Chromosome 14q21
Reference DDBJ accession
UniGene Hs.444749
5'-terminal sequence GAGGCGAGAGCTGCGAAAGGCGAGAGCTGCGAAGGGCCAGGTGTCGGGCGCTGTTTCTCG
2011.08.28