Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00874

HP ID(1) HP00874
Gene ID(2) 4736
Gene Symbol finder RPL10A
Protein Name ribosomal protein L10a
RefSeq NM_007104.4
Length of RefSeq (bp) 719
Chromosome 6p21.3-p21.2
Reference DDBJ accession
UniGene Hs.546269

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10G07 pKA1U5 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARe14C08 pKA1U5 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARe16F08 pKA1U5 GTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
ARe30E12 pKA1U5 TGGAGGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCG
ARe34E06 pKA1U5 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGANCAGCAAAGTCTCTCGCGACACCC
ARe39E08 pKA1U5 TGCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
ARe44B06 pKA1U5 CTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
ARe52B08 pKA1U5 GCTCTTTTTTCCGGTTAGCGNGATCGTGAGAANCCCTNAGCAGCAAAGTCTCTCGCGACA
ARe55B12 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCCTGTATCAGCAAAGTCTCTCGCGACACC
ARe55C01 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGANCAGCAAAGTCTCTCGCGACACCC
ARe62H01 pKA1U5 GTCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGCAGCAGCAAAGTTCTCTCGCGACA
ARe67E08 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARe77D01 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCCTGANCAGCAAAGTCTCTCGCGACACCC
ARe78A03 pKA1U5 TGGCGTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACA
ARe86C07 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARe92B08 pKA1U5 TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
ARe93C08 pKA1U5 ATCCTGCTTTTTCCGGTTAACGCGGCGTGGAGAAGCCATGAGCAGCAAAGTCTCTCGCGA
ARe96B03 pKA1U5 CTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
ARe98G02 pKA1U5 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARf02A01 pKA1U5 GCTCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACAC
ARf02E10 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARf07G06 pKA1U5 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGCAGCAGCAAAGTCTCTCGCGACACC
ARi07G04 pGCAP10 TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
ARi19A07 pGCAP10 CTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
ARi28G06 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARi40F03 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARi41G06 pGCAP10 GACAAAGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCG
ARi53E05 pGCAP10 GTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
ARiS020O01 pGCAP10 GCCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
ARiS045D08 pGCAP10 CGGCCGGCCGATGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCT
ARiS085K24 pGCAP10 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARiS088G18 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARiS088O12 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARiS096M22 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARiS109O09 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARiS122J10 pGCAP10 GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
ARiS191K11 pGCAP10 TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
RBb04D08 pKA1U5 GTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
RBb06C05 pKA1U5 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb21F09 pKA1U5 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb27F04 pGCAP1 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb31C12 pGCAP1
RBb33H09 pGCAP1 GCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTG
RBb36E09 pGCAP1 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb47C09 pGCAP1
RBb47F03 pGCAP1 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb49C12 pGCAP1 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb53G02 pGCAP1 TGTGCTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGA
RBb53H12 pGCAP1 GTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
RBb59B10 pGCAP1 TTAAACTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGAC
RBb61F03 pGCAP1 TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
RBb64F06 pGCAP1 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBb69H03 pGCAP1 TCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd04F03 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd40G02 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd54A05 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAANTCTCTCGCGACACCC
RBd59G03 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd62G01 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd72H09 pGCAP10 GAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACA
RBd76C05 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd80A03 pGCAP10 GCTCTTTTNGGGNNNNCGCGGNGTGANANNNCNTGANNNNNNNAGTCTCTNNCGACNCCC
RBd80F02 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBd84A05 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBdS015B18 pGCAP10 ACAGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACA
RBdS015P12 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBdS022O19 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTA
RBdS075D21 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBdS081K22 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBdS083M07 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
RBdS105M13 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTA
RBdS177P13 pGCAP10 GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl