Prev. |  KEGG KO K02865 > 

RIKEN DNA Bank Human Resource - RPL10A

Gene ID NCBI Gene 4736 |  KEGG hsa:4736
Gene Symbol RPL10A
Protein Name ribosomal protein L10a
Synonyms CSA19|Csa-19|L10A|NEDD6
Ortholog resources KEGG ortholog (KEGG orthology K02865) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001561 IRAK003P01 pCMV-SPORT6 BC006791 NM_007104 Full
HGX001283 IRAK003D11 pCMV-SPORT6 BC011366 NM_007104 Full
HGY103028 IRAL057J12 pDNR-LIB BC070216 NM_007104 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044151 ARe10G07 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR045656 ARe14C08 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR046528 ARe16F08 pKA1U5 NM_007104.4  
GTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR052108 ARe30E12 pKA1U5 NM_007104.4  
TGGAGGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCG
HKR053702 ARe34E06 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGANCAGCAAAGTCTCTCGCGACACCC
HKR055704 ARe39E08 pKA1U5 NM_007104.4  
TGCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR057630 ARe44B06 pKA1U5 NM_007104.4  
CTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
HKR060832 ARe52B08 pKA1U5 NM_007104.4  
GCTCTTTTTTCCGGTTAGCGNGATCGTGAGAANCCCTNAGCAGCAAAGTCTCTCGCGACA
HKR062036 ARe55B12 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCCTGTATCAGCAAAGTCTCTCGCGACACC
HKR062049 ARe55C01 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGANCAGCAAAGTCTCTCGCGACACCC
HKR064969 ARe62H01 pKA1U5 NM_007104.4  
GTCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGCAGCAGCAAAGTTCTCTCGCGACA
HKR066904 ARe67E08 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR070873 ARe77D01 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCCTGANCAGCAAAGTCTCTCGCGACACCC
HKR071203 ARe78A03 pKA1U5 NM_007104.4  
TGGCGTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACA
HKR074455 ARe86C07 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR076832 ARe92B08 pKA1U5 NM_007104.4  
TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR077256 ARe93C08 pKA1U5 NM_007104.4  
ATCCTGCTTTTTCCGGTTAACGCGGCGTGGAGAAGCCATGAGCAGCAAAGTCTCTCGCGA
HKR078427 ARe96B03 pKA1U5 NM_007104.4  
CTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
HKR079346 ARe98G02 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR080801 ARf02A01 pKA1U5 NM_007104.4  
GCTCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACAC
HKR080906 ARf02E10 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR082950 ARf07G06 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGCAGCAGCAAAGTCTCTCGCGACACC
HKR162948 ARi07G04 pGCAP10 NM_007104.4  
TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR167607 ARi19A07 pGCAP10 NM_007104.4  
CTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
HKR171350 ARi28G06 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR176123 ARi40F03 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR176550 ARi41G06 pGCAP10 NM_007104.4  
GACAAAGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCG
HKR181301 ARi53E05 pGCAP10 NM_007104.4  
GTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCT
HKR208337 ARiS020O01 pGCAP10 NM_007104.4  
GCCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR218080 ARiS045D08 pGCAP10 NM_007104.4  
CGGCCGGCCGATGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCT
HKR234264 ARiS085K24 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR235362 ARiS088G18 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR235548 ARiS088O12 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR238710 ARiS096M22 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR243945 ARiS109O09 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR249026 ARiS122J10 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAACGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR276651 ARiS191K11 pGCAP10 NM_007104.4  
TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR321680 RBb04D08 pKA1U5 NM_007104.4  
GTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR322453 RBb06C05 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR328529 RBb21F09 pKA1U5 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR330924 RBb27F04 pGCAP1 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR332460 RBb31C12 pGCAP1 NM_007104.4  
HKR333377 RBb33H09 pGCAP1 NM_007104.4  
GCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCCTG
HKR334505 RBb36E09 pGCAP1 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR338857 RBb47C09 pGCAP1 NM_007104.4  
HKR338923 RBb47F03 pGCAP1 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR339660 RBb49C12 pGCAP1 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR341346 RBb53G02 pGCAP1 NM_007104.4  
TGTGCTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGA
HKR341380 RBb53H12 pGCAP1 NM_007104.4  
GTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR343634 RBb59B10 pGCAP1 NM_007104.4  
TTAAACTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGAC
HKR344523 RBb61F03 pGCAP1 NM_007104.4  
TGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACC
HKR345726 RBb64F06 pGCAP1 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR347771 RBb69H03 pGCAP1 NM_007104.4  
TCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR361723 RBd04F03 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR376146 RBd40G02 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR381605 RBd54A05 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAANTCTCTCGCGACACCC
HKR383747 RBd59G03 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR384945 RBd62G01 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR388977 RBd72H09 pGCAP10 NM_007104.4  
GAGTCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACA
HKR390453 RBd76C05 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR392003 RBd80A03 pGCAP10 NM_007104.4  
GCTCTTTTNGGGNNNNCGCGGNGTGANANNNCNTGANNNNNNNAGTCTCTNNCGACNCCC
HKR392122 RBd80F02 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR393605 RBd84A05 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR406042 RBdS015B18 pGCAP10 NM_007104.4  
ACAGCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACA
HKR406372 RBdS015P12 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR409155 RBdS022O19 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTA
HKR430093 RBdS075D21 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR432662 RBdS081K22 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR433495 RBdS083M07 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC
HKR442301 RBdS105M13 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTA
HKR471173 RBdS177P13 pGCAP10 NM_007104.4  
GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGCAGCAAAGTCTCTCGCGACACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl