Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105M13

Clone ID RBdS105M13
HP ID HP00874
Gene ID 4736
Gene Symbol RPL10A
Protein Name ribosomal protein L10a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007104.4
Length of RefSeq (bp) 719
Chromosome 6p21.3-p21.2
Reference DDBJ accession
UniGene Hs.546269
5'-terminal sequence GCTCTTTTCCGGTTAGCGCGGCGTGAGAAGCCATGAGGTGAGTTGGTCCTGAAAGCCCTA
2011.08.28