Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00851

HP ID(1) HP00851
Gene ID(2) 8766
Gene Symbol finder RAB11A
Protein Name RAB11A, member RAS oncogene family
RefSeq NM_004663.3
Length of RefSeq (bp) 2393
Chromosome 15q21.3-q22.31
Reference DDBJ accession
UniGene Hs.321541

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi04H07 pGCAP10 GAGTTGAAGCTCGGCGCTCGGGTTACCCCTGCAGCGACGCCCCCTGGTCCCACAGATACC
ARiS049D22 pGCAP10 GAGTTGAAGCTCGGCGCTCGGGTTACCCCTGCAGCGACGCCCCCTGGTCCCACAGATACC
ARiS150H03 pGCAP10 GGGCAGGGAGGGGCTCTTCACCCAGTCCGGCAGTTGAAGCTCGGCGCTCGGGTTACCCCT
ARiS150O21 pGCAP10 GACCCAGTCCGGCAGTTGAAGCTCGGCGCTCGGGTTACCCCTGCAGCGACGCCCCCTGGT
ARiS194K04 pGCAP10 GAGCGGCAGGGAGGGGCTCTTCACCCAGTCCGGCAGTTGAAGCTCGGCGCTCGGGTTACC
RBb46C02 pGCAP1 GCCTCCTCGGCCGCGCAATGGGCACCCGCGACGACGAGTACGACTACCTCTTTAAAGTTG
RBdS154C12 pGCAP10 GACTGCTGCTCCCGCCCTTTCGCTCCTCGGCCGCGCAATGGGCACCCGCGACGACGAGTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl