Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154C12

Clone ID RBdS154C12
HP ID HP00851
Gene ID 8766
Gene Symbol RAB11A
Protein Name RAB11A, member RAS oncogene family
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004663.3
Length of RefSeq (bp) 2393
Chromosome 15q21.3-q22.31
Reference DDBJ accession
UniGene Hs.321541
5'-terminal sequence GACTGCTGCTCCCGCCCTTTCGCTCCTCGGCCGCGCAATGGGCACCCGCGACGACGAGTA
2011.08.28