Prev. |  KEGG KO K07904 > 

RIKEN DNA Bank Human Resource - RAB11A

Gene ID NCBI Gene 8766 |  KEGG hsa:8766
Gene Symbol RAB11A
Protein Name RAB11A, member RAS oncogene family
Synonyms YL8
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  RAB11A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083136 IRAL007N24 pOTB7 BC013348 NM_004663 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000618 W01A001J02 pENTR-TOPO IRAL007N24 BC013348 NM_004663  
HGE000620 W01A001J04 pENTR-TOPO IRAL007N24 BC013348 NM_004663  
HGE000622 W01A001J06 pENTR-TOPO IRAL007N24 BC013348 NM_004663  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161775 ARi04H07 pGCAP10 NM_004663.3  
GAGTTGAAGCTCGGCGCTCGGGTTACCCCTGCAGCGACGCCCCCTGGTCCCACAGATACC
HKR219694 ARiS049D22 pGCAP10 NM_004663.3  
GAGTTGAAGCTCGGCGCTCGGGTTACCCCTGCAGCGACGCCCCCTGGTCCCACAGATACC
HKR260171 ARiS150H03 pGCAP10 NM_004663.3  
GGGCAGGGAGGGGCTCTTCACCCAGTCCGGCAGTTGAAGCTCGGCGCTCGGGTTACCCCT
HKR260357 ARiS150O21 pGCAP10 NM_004663.3  
GACCCAGTCCGGCAGTTGAAGCTCGGCGCTCGGGTTACCCCTGCAGCGACGCCCCCTGGT
HKR277844 ARiS194K04 pGCAP10 NM_004663.3  
GAGCGGCAGGGAGGGGCTCTTCACCCAGTCCGGCAGTTGAAGCTCGGCGCTCGGGTTACC
HKR338450 RBb46C02 pGCAP1 NM_004663.3  
GCCTCCTCGGCCGCGCAATGGGCACCCGCGACGACGAGTACGACTACCTCTTTAAAGTTG
HKR461660 RBdS154C12 pGCAP10 NM_004663.3  
GACTGCTGCTCCCGCCCTTTCGCTCCTCGGCCGCGCAATGGGCACCCGCGACGACGAGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.03.27

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl