Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00814

HP ID(1) HP00814
Gene ID(2) 51121
Gene Symbol finder RPL26L1
Protein Name ribosomal protein L26-like 1
RefSeq NM_016093.2
Length of RefSeq (bp) 723
Chromosome 5q35.2
Reference DDBJ accession
UniGene Hs.546390

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe32B11 pKA1U5 GAGGGTCTGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCT
ARe57D08 pKA1U5 GGACAGTGAACTCTACCGCCCCGTGAGACCCTGCCCTATGTGTCGCGGGAACACATGTCA
ARiS045C16 pGCAP10 GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
ARiS055P05 pGCAP10 GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
ARiS194O07 pGCAP10 GGAGGCANCTAGTANCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
RBd20F04 pGCAP10 GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
RBd60G07 pGCAP10 GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
RBdS015I05 pGCAP10 GCTGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGAC
RBdS156F07 pGCAP10 GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl