Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015I05

Clone ID RBdS015I05
HP ID HP00814
Gene ID 51121
Gene Symbol RPL26L1
Protein Name ribosomal protein L26-like 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016093.2
Length of RefSeq (bp) 723
Chromosome 5q35.2
Reference DDBJ accession
UniGene Hs.546390
5'-terminal sequence GCTGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGAC
2011.08.28