Prev. |  KEGG KO K02898 > 

RIKEN DNA Bank Human Resource - RPL26L1

Gene ID NCBI Gene 51121 |  KEGG hsa:51121
Gene Symbol RPL26L1
Protein Name ribosomal protein L26 like 1
Synonyms RPL26P1
Ortholog resources KEGG ortholog (KEGG orthology K02898) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095688 IRAL039D16 pOTB7 BC017360 NM_016093
HGY103136 IRAL057N24 pDNR-LIB BC070192 NM_016093 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052835 ARe32B11 pKA1U5 NM_016093.2  
GAGGGTCTGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCT
HKR062880 ARe57D08 pKA1U5 NM_016093.2  
GGACAGTGAACTCTACCGCCCCGTGAGACCCTGCCCTATGTGTCGCGGGAACACATGTCA
HKR218064 ARiS045C16 pGCAP10 NM_016093.2  
GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
HKR222365 ARiS055P05 pGCAP10 NM_016093.2  
GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
HKR277943 ARiS194O07 pGCAP10 NM_016093.2  
GGAGGCANCTAGTANCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
HKR368124 RBd20F04 pGCAP10 NM_016093.2  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR384151 RBd60G07 pGCAP10 NM_016093.2  
GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG
HKR406197 RBdS015I05 pGCAP10 NM_016093.2  
GCTGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGAC
HKR462527 RBdS156F07 pGCAP10 NM_016093.2  
GGAGGCAGCTAGTAGCCGGAGGGTCACCATGAAGTTCAATCCCTTCGTTACCTCGGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl