Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00795

HP ID(1) HP00795
Gene ID(2) 25873
Gene Symbol finder RPL36
Protein Name ribosomal protein L36
RefSeq NM_033643.2
Length of RefSeq (bp) 453
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.408018

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12B11 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARe30B07 pKA1U5 GGTTCTTGCCTCTCTGGCCTGCGCCTCCTGAGCCGAGTAGATATCCCGGAGTTCCGCGCG
ARe32C06 pKA1U5 GACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTC
ARe40A03 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARe41G06 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARe42B07 pKA1U5 GACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTC
ARe43E11 pKA1U5 GGCGCGGCGCCAGCCCTTCCGCCACGGCCGTTCTCTGTAGAGCAGCAGCCATGGCCCTAC
ARe46G10 pKA1U5 GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
ARe49D09 pKA1U5 GGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCC
ARe50H12 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARe58G03 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARe74F09 pKA1U5 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARe76D03 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCACCCNTGGCCCTACGCTACCCTATGGCC
ARe78C03 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARe78F02 pKA1U5 GGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCC
ARe84F12 pKA1U5 GGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATG
ARe92E07 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARf03G02 pKA1U5 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARi05F03 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARi07D01 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARi13H11 pGCAP10 GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
ARi15E04 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARi25C09 pGCAP10 TGGGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCA
ARi43G10 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARi45H05 pGCAP10 TGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARi47A08 pGCAP10 GGCACTGCCGGTATCCGCCGCCATCCGGACTCCCGGGTCCTCTGTGCAGGTTGGAGGATG
ARi62E12 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARi63B11 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARi63G07 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARiS049F15 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARiS049P02 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARiS088D15 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARiS109A03 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
ARiS122C03 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
ARiS161L21 pGCAP10 GCTTCCNCNNCGGCCGTCNCNNCNNANNNTCANCNNTGGCCCTACGCTACCCTATGNNCG
ARiS194J20 pGCAP10 TGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBb14C04 pKA1U5
RBb32B04 pGCAP1 GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTTACCCTATGG
RBb34F12 pGCAP1 AGTGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGG
RBb36H05 pGCAP1 GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
RBb42C01 pGCAP1 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBb46B04 pGCAP1 GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
RBb69G12 pGCAP1 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBd07D03 pGCAP10 GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
RBd08A12 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBd11F05 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBd15H04 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBd25A12 pGCAP10 GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
RBd31D01 pGCAP10 GAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATG
RBd33C10 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBd34G01 pGCAP10 TTTGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGG
RBd39C11 pGCAP10 GGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCC
RBd44D09 pGCAP10 TGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBd45G02 pGCAP10 TGGTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBd47A03 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBd47C08 pGCAP10 GTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGT
RBd56F07 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCNCNANNNNACCCTATGGCCG
RBd59H04 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBd74H04 pGCAP10 GGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGG
RBd75G06 pGCAP10 GACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTC
RBd80A01 pGCAP10 GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
RBd82D05 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBd85E04 pGCAP10 CGGCCGGCCGATGGTAGATATCCCGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCC
RBdS007H19 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS022J10 pGCAP10 GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
RBdS040G04 pGCAP10 GGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGC
RBdS075B21 pGCAP10 GGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACC
RBdS075D23 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBdS075I19 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBdS081H01 pGCAP10 GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
RBdS081N03 pGCAP10 GGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACC
RBdS104F09 pGCAP10 GGATATCCCGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAG
RBdS104I07 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBdS104N01 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS105M09 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS105O05 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGGTAAGTGGTTTCCCGCACTGCCGGTAT
RBdS105P05 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS110A10 pGCAP10 GAGCAGGTAAGTGGTTTCCCGCACTGCCGGTATCCGCCGCCATCCGGACTCCCGGGTCCT
RBdS110L09 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS154A10 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS154B17 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBdS156D10 pGCAP10 GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
RBdS177M02 pGCAP10 GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
RBdS187F03 pGCAP10 CGGCCGGCCGATGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCT
RBdS187J03 pGCAP10 GCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl