Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081H01

Clone ID RBdS081H01
HP ID HP00795
Gene ID 25873
Gene Symbol RPL36
Protein Name ribosomal protein L36
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_033643.2
Length of RefSeq (bp) 453
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.408018
5'-terminal sequence GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
2011.08.28