Prev. |  KEGG KO K02920 > 

RIKEN DNA Bank Human Resource - RPL36

Gene ID NCBI Gene 25873 |  KEGG hsa:25873
Gene Symbol RPL36
Protein Name ribosomal protein L36
Synonyms L36
Ortholog resources KEGG ortholog (KEGG orthology K02920) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083484 IRAL008L20 pOTB7 BC003052 NM_033643 Full
HGY083928 IRAL009N16 pOTB7 BC004971 NM_033643 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044835 ARe12B11 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR052031 ARe30B07 pKA1U5 NM_033643.2  
GGTTCTTGCCTCTCTGGCCTGCGCCTCCTGAGCCGAGTAGATATCCCGGAGTTCCGCGCG
HKR052854 ARe32C06 pKA1U5 NM_033643.2  
GACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTC
HKR056003 ARe40A03 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR056550 ARe41G06 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR056831 ARe42B07 pKA1U5 NM_033643.2  
GACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTC
HKR057307 ARe43E11 pKA1U5 NM_033643.2  
GGCGCGGCGCCAGCCCTTCCGCCACGGCCGTTCTCTGTAGAGCAGCAGCCATGGCCCTAC
HKR058554 ARe46G10 pKA1U5 NM_033643.2  
GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
HKR059681 ARe49D09 pKA1U5 NM_033643.2  
GGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCC
HKR060180 ARe50H12 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR063347 ARe58G03 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR069729 ARe74F09 pKA1U5 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR070475 ARe76D03 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCACCCNTGGCCCTACGCTACCCTATGGCC
HKR071251 ARe78C03 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR071322 ARe78F02 pKA1U5 NM_033643.2  
GGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCC
HKR073732 ARe84F12 pKA1U5 NM_033643.2  
GGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATG
HKR076903 ARe92E07 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR081346 ARf03G02 pKA1U5 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR162123 ARi05F03 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR162873 ARi07D01 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR165379 ARi13H11 pGCAP10 NM_033643.2  
GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
HKR166100 ARi15E04 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR170057 ARi25C09 pGCAP10 NM_033643.2  
TGGGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCA
HKR177354 ARi43G10 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR178173 ARi45H05 pGCAP10 NM_033643.2  
TGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR178808 ARi47A08 pGCAP10 NM_033643.2  
GGCACTGCCGGTATCCGCCGCCATCCGGACTCCCGGGTCCTCTGTGCAGGTTGGAGGATG
HKR184908 ARi62E12 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR185235 ARi63B11 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR185351 ARi63G07 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR219735 ARiS049F15 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR219962 ARiS049P02 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR235287 ARiS088D15 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR243603 ARiS109A03 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR248851 ARiS122C03 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR264685 ARiS161L21 pGCAP10 NM_033643.2  
GCTTCCNCNNCGGCCGTCNCNNCNNANNNTCANCNNTGGCCCTACGCTACCCTATGNNCG
HKR277836 ARiS194J20 pGCAP10 NM_033643.2  
TGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR325652 RBb14C04 pKA1U5 NM_033643.2  
HKR332828 RBb32B04 pGCAP1 NM_033643.2  
GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTTACCCTATGG
HKR333732 RBb34F12 pGCAP1 NM_033643.2  
AGTGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGG
HKR334573 RBb36H05 pGCAP1 NM_033643.2  
GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
HKR336849 RBb42C01 pGCAP1 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR338428 RBb46B04 pGCAP1 NM_033643.2  
GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
HKR347756 RBb69G12 pGCAP1 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR362875 RBd07D03 pGCAP10 NM_033643.2  
GCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGC
HKR363212 RBd08A12 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR364525 RBd11F05 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR366172 RBd15H04 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR370012 RBd25A12 pGCAP10 NM_033643.2  
GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
HKR372473 RBd31D01 pGCAP10 NM_033643.2  
GAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATG
HKR373258 RBd33C10 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR373745 RBd34G01 pGCAP10 NM_033643.2  
TTTGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGG
HKR375659 RBd39C11 pGCAP10 NM_033643.2  
GGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCC
HKR377681 RBd44D09 pGCAP10 NM_033643.2  
TGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR378146 RBd45G02 pGCAP10 NM_033643.2  
TGGTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR378803 RBd47A03 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR378856 RBd47C08 pGCAP10 NM_033643.2  
GTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGT
HKR382527 RBd56F07 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCNCNANNNNACCCTATGGCCG
HKR383772 RBd59H04 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR389772 RBd74H04 pGCAP10 NM_033643.2  
GGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGG
HKR390150 RBd75G06 pGCAP10 NM_033643.2  
GACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTC
HKR392001 RBd80A01 pGCAP10 NM_033643.2  
GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
HKR392877 RBd82D05 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR394100 RBd85E04 pGCAP10 NM_033643.2  
CGGCCGGCCGATGGTAGATATCCCGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCC
HKR402987 RBdS007H19 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR409026 RBdS022J10 pGCAP10 NM_033643.2  
GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
HKR416148 RBdS040G04 pGCAP10 NM_033643.2  
GGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGC
HKR430045 RBdS075B21 pGCAP10 NM_033643.2  
GGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACC
HKR430095 RBdS075D23 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR430211 RBdS075I19 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR432569 RBdS081H01 pGCAP10 NM_033643.2  
GGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCT
HKR432715 RBdS081N03 pGCAP10 NM_033643.2  
GGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACC
HKR441729 RBdS104F09 pGCAP10 NM_033643.2  
GGATATCCCGGAGTTCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAG
HKR441799 RBdS104I07 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR441913 RBdS104N01 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR442297 RBdS105M09 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR442341 RBdS105O05 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGGTAAGTGGTTTCCCGCACTGCCGGTAT
HKR442365 RBdS105P05 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR444010 RBdS110A10 pGCAP10 NM_033643.2  
GAGCAGGTAAGTGGTTTCCCGCACTGCCGGTATCCGCCGCCATCCGGACTCCCGGGTCCT
HKR444273 RBdS110L09 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR461610 RBdS154A10 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR461641 RBdS154B17 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR462482 RBdS156D10 pGCAP10 NM_033643.2  
GCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCC
HKR471090 RBdS177M02 pGCAP10 NM_033643.2  
GCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCG
HKR474923 RBdS187F03 pGCAP10 NM_033643.2  
CGGCCGGCCGATGCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCT
HKR475019 RBdS187J03 pGCAP10 NM_033643.2  
GCCGCGCGGCGCCAGCCCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl