Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00739

HP ID(1) HP00739
Gene ID(2) 7494
Gene Symbol finder XBP1
Protein Name X-box binding protein 1
RefSeq NM_005080.3
Length of RefSeq (bp) 1820
Chromosome 22q12.1; 22q12
Reference DDBJ accession
UniGene Hs.437638

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25G01 pKA1U5 GGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACG
ARi05H08 pGCAP10 GCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTT
RBdS105P03 pGCAP10 GGGTGTGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGAC
RBdS110M10 pGCAP10 GGGGCGCGGCGAGGCTGGGCGCTGGGCGGCTGCGGCGCGCGGTGCGCGGTGCGTAGTCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl