DNA Bank Top |  KEGG KO K09027 > 

RIKEN DNA Bank Human Resource - XBP1

Gene ID NCBI Gene 7494 |  KEGG hsa:7494
Gene Symbol XBP1
Protein Name X-box binding protein 1
Synonyms TREB-5|TREB5|XBP-1|XBP2

Link

Ortholog resource in our bank

  XBP1


External database

human XBP1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB06272 pCMFlag_hsXBP1 Expression vector of human XBP1.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001328 IRAK003F08 pCMV-SPORT6 BC000938 NM_005080 Full
HGX008408 IRAK021A08 pCMV-SPORT6 BC012841 NM_005080 Full
HGX006214 IRAK015I22 pCMV-SPORT6 BC015709 NM_005080 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050145 ARe25G01 pKA1U5 NM_005080.3 done
GGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACG
HKR162176 ARi05H08 pGCAP10 NM_005080.3  
GCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTT
HKR442363 RBdS105P03 pGCAP10 NM_005080.3  
GGGTGTGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGAC
HKR444298 RBdS110M10 pGCAP10 NM_005080.3  
GGGGCGCGGCGAGGCTGGGCGCTGGGCGGCTGCGGCGCGCGGTGCGCGGTGCGTAGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2025.03.19

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl