Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110M10

Clone ID RBdS110M10
HP ID HP00739
Gene ID 7494
Gene Symbol XBP1
Protein Name X-box binding protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005080.3
Length of RefSeq (bp) 1820
Chromosome 22q12.1; 22q12
Reference DDBJ accession
UniGene Hs.437638
5'-terminal sequence GGGGCGCGGCGAGGCTGGGCGCTGGGCGGCTGCGGCGCGCGGTGCGCGGTGCGTAGTCTG
2011.08.28