Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00734

HP ID(1) HP00734
Gene ID(2) 5867
Gene Symbol finder RAB4A
Protein Name RAB4A, member RAS oncogene family
RefSeq NM_004578.2
Length of RefSeq (bp) 1861
Chromosome 1q42-q43
Reference DDBJ accession
UniGene Hs.296169

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS081B23 pGCAP10 GGGAGGGCCCTGCGCCTGCGCGGAGCTGGAGTCCGGCTGGGCCGCAGCCGCTGGGAGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl