Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAB4A

Gene ID (NCBI) 5867
Gene Symbol RAB4A
Protein Name RAB4A, member RAS oncogene family
Synonyms HRES-1|HRES-1/RAB4|HRES1|RAB4
Databases KEGG hsa:5867 |  NCBI Gene 5867
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07879)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082208 IRAL005I16 pOTB7 BC002438 NM_004578 Full
HGY085352 IRAL013G08 pOTB7 BC004309 NM_004578

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR432447 RBdS081B23 pGCAP10 NM_004578.2  
GGGAGGGCCCTGCGCCTGCGCGGAGCTGGAGTCCGGCTGGGCCGCAGCCGCTGGGAGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.03.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190131.pl