Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081B23

Clone ID RBdS081B23
HP ID HP00734
Gene ID 5867
Gene Symbol RAB4A
Protein Name RAB4A, member RAS oncogene family
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004578.2
Length of RefSeq (bp) 1861
Chromosome 1q42-q43
Reference DDBJ accession
UniGene Hs.296169
5'-terminal sequence GGGAGGGCCCTGCGCCTGCGCGGAGCTGGAGTCCGGCTGGGCCGCAGCCGCTGGGAGACC
2011.08.28