Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00595

HP ID(1) HP00595
Gene ID(2) 6235
Gene Symbol finder RPS29
Protein Name ribosomal protein S29
RefSeq NM_001032.3
Length of RefSeq (bp) 302
Chromosome 14q
Reference DDBJ accession
UniGene Hs.156367

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05G07 pKA1U5 GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
ARe10G10 pKA1U5 GCTTTTACCTCGNTTGCACTGCTGAGAGCAAGATGGGTTCACCAGCAGCTGTACTGGAGC
ARe13G01 pKA1U5 GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARe33D12 pKA1U5 GCCTTTTACCTCGNTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
ARe38D10 pKA1U5 GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARe38E07 pKA1U5 GCTTCCTTTTCCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAG
ARe46F06 pKA1U5 ATCCTGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGG
ARe48E01 pKA1U5 GTTTTTTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
ARe65C07 pKA1U5 GCCTTTTACCTCGNTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
ARe71A07 pKA1U5 TTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGG
ARe74F12 pKA1U5 TGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARe85E08 pKA1U5 GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
ARe87B03 pKA1U5 GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARf03F01 pKA1U5 GCTTTTTTCCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARi17C07 pGCAP10 GAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGAT
ARi23B10 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
ARi29C02 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
ARi40A09 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
ARi43F07 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
ARi61C10 pGCAP10 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
ARi62C06 pGCAP10 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
ARiS020I14 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
ARiS020I23 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
ARiS020L08 pGCAP10 GAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCG
ARiS085A16 pGCAP10 TTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARiS088C10 pGCAP10 GCTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
ARiS118B19 pGCAP10 GCCTTTNACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
ARiS122G07 pGCAP10 CGGCCGGCCGATACCTCNTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
ARiS150J22 pGCAP10 GGTGNTGNNTNNTTGCNCNGCTGAAAGGAAGATGGTTCACCNNCNTNTGGNCNGGANCCA
ARiS150N14 pGCAP10 GNGNCTGCCGNTGCCGNCCTGGNNCTCCCAGGNNCNGNCANACCTTGNGACCNGNGAGCG
RBb15G08 pKA1U5 GCTTTTCCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
RBb17C07 pKA1U5 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBb19A03 pKA1U5 TTGCTCTCAAAAATTTGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGC
RBb20G02 pKA1U5 GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBb32D11 pGCAP1
RBb36D11 pGCAP1 TTGGTGCCTTTTCCTCGCTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
RBb39D04 pGCAP1 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
RBb41C04 pGCAP1 TTCTTCCTTTTACCTCGTTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
RBb41E07 pGCAP1 TGTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
RBb43C06 pGCAP1
RBb44B07 pGCAP1 GTGTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTAC
RBb48C03 pGCAP1 AAATTTGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGNTTGCACTGCTGAG
RBb51A07 pGCAP1 TATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCAC
RBd01G05 pGCAP10 GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBd02G04 pGCAP10 GCTTTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
RBd18D01 pGCAP10 GGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAG
RBd22D03 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd27C01 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd27C05 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd27E01 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd38A09 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd48A10 pGCAP10 GATTCTGGGTAAACTGTCTCAAAAATTTGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTT
RBd51F05 pGCAP10 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
RBd52A11 pGCAP10 AGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBd57D11 pGCAP10 GATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGNNCAGGGTTCTCGCTC
RBd58B04 pGCAP10 GCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGA
RBd61E06 pGCAP10 GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
RBd63H12 pGCAP10 GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBd64B01 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd64D10 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd65F07 pGCAP10 GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBd66D08 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd72C11 pGCAP10 GTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
RBd74E07 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd75E02 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd77A07 pGCAP10 TGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBd85D10 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBd89B02 pGCAP10 GGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTC
RBd94H09 pGCAP10 GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
RBd95H06 pGCAP10 GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBd98E05 pGCAP10 GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBdS007F09 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBdS015C19 pGCAP10 TGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBdS015L16 pGCAP10 GGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAG
RBdS022E11 pGCAP10 GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
RBdS040B04 pGCAP10 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
RBdS051O22 pGCAP10 CGGCCGGCCGATTATGCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGC
RBdS070B01 pGCAP10 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
RBdS070E19 pGCAP10 GTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
RBdS070L10 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBdS075F10 pGCAP10 CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
RBdS104O08 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBdS154H16 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBdS154J20 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
RBdS156C07 pGCAP10 GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
RBdS187K13 pGCAP10 GTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
RBdS187E05 pGCAP10 GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl