Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070L10

Clone ID RBdS070L10
HP ID HP00595
Gene ID 6235
Gene Symbol RPS29
Protein Name ribosomal protein S29
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001032.3
Length of RefSeq (bp) 302
Chromosome 14q
Reference DDBJ accession
UniGene Hs.156367
5'-terminal sequence GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
2011.08.28