Prev. |  KEGG KO K02980 > 

RIKEN DNA Bank Human Resource - RPS29

Gene ID NCBI Gene 6235 |  KEGG hsa:6235
Gene Symbol RPS29
Protein Name ribosomal protein S29
Synonyms DBA13|S29
Ortholog resources KEGG ortholog (KEGG orthology K02980) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005394 IRAK013I02 pCMV-SPORT6 BC035313 NM_001032 Full
HGX027577 IRAK068P17 pCMV-SPORT6 BC032813 NM_001032 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042151 ARe05G07 pKA1U5 NM_001032.3  
GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
HKR044154 ARe10G10 pKA1U5 NM_001032.3  
GCTTTTACCTCGNTTGCACTGCTGAGAGCAAGATGGGTTCACCAGCAGCTGTACTGGAGC
HKR045345 ARe13G01 pKA1U5 NM_001032.3  
GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR053284 ARe33D12 pKA1U5 NM_001032.3  
GCCTTTTACCTCGNTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
HKR055282 ARe38D10 pKA1U5 NM_001032.3  
GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR055303 ARe38E07 pKA1U5 NM_001032.3  
GCTTCCTTTTCCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAG
HKR058526 ARe46F06 pKA1U5 NM_001032.3  
ATCCTGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGG
HKR059297 ARe48E01 pKA1U5 NM_001032.3  
GTTTTTTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
HKR066055 ARe65C07 pKA1U5 NM_001032.3  
GCCTTTTACCTCGNTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
HKR068407 ARe71A07 pKA1U5 NM_001032.3  
TTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGG
HKR069732 ARe74F12 pKA1U5 NM_001032.3  
TGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR074104 ARe85E08 pKA1U5 NM_001032.3  
GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
HKR074827 ARe87B03 pKA1U5 NM_001032.3  
GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR081321 ARf03F01 pKA1U5 NM_001032.3  
GCTTTTTTCCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR166855 ARi17C07 pGCAP10 NM_001032.3  
GAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGAT
HKR169234 ARi23B10 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR171650 ARi29C02 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR176009 ARi40A09 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR177327 ARi43F07 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR184458 ARi61C10 pGCAP10 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR184854 ARi62C06 pGCAP10 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR208206 ARiS020I14 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR208215 ARiS020I23 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR208272 ARiS020L08 pGCAP10 NM_001032.3  
GAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGGCCAGGGTTCTCG
HKR234016 ARiS085A16 pGCAP10 NM_001032.3  
TTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR235258 ARiS088C10 pGCAP10 NM_001032.3  
GCTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
HKR247243 ARiS118B19 pGCAP10 NM_001032.3  
GCCTTTNACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR248951 ARiS122G07 pGCAP10 NM_001032.3  
CGGCCGGCCGATACCTCNTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
HKR260238 ARiS150J22 pGCAP10 NM_001032.3  
GGTGNTGNNTNNTTGCNCNGCTGAAAGGAAGATGGTTCACCNNCNTNTGGNCNGGANCCA
HKR260326 ARiS150N14 pGCAP10 NM_001032.3  
GNGNCTGCCGNTGCCGNCCTGGNNCTCCCAGGNNCNGNCANACCTTGNGACCNGNGAGCG
HKR326152 RBb15G08 pKA1U5 NM_001032.3  
GCTTTTCCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR326855 RBb17C07 pKA1U5 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR327603 RBb19A03 pKA1U5 NM_001032.3  
TTGCTCTCAAAAATTTGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGC
HKR328146 RBb20G02 pKA1U5 NM_001032.3  
GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR332883 RBb32D11 pGCAP1 NM_001032.3  
HKR334483 RBb36D11 pGCAP1 NM_001032.3  
TTGGTGCCTTTTCCTCGCTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
HKR335676 RBb39D04 pGCAP1 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR336452 RBb41C04 pGCAP1 NM_001032.3  
TTCTTCCTTTTACCTCGTTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
HKR336503 RBb41E07 pGCAP1 NM_001032.3  
TGTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGC
HKR337254 RBb43C06 pGCAP1 NM_001032.3  
HKR337631 RBb44B07 pGCAP1 NM_001032.3  
GTGTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTAC
HKR339251 RBb48C03 pGCAP1 NM_001032.3  
AAATTTGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGNTTGCACTGCTGAG
HKR340407 RBb51A07 pGCAP1 NM_001032.3  
TATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCAC
HKR360549 RBd01G05 pGCAP10 NM_001032.3  
GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR360948 RBd02G04 pGCAP10 NM_001032.3  
GCTTTTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
HKR367273 RBd18D01 pGCAP10 NM_001032.3  
GGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAG
HKR368875 RBd22D03 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR370849 RBd27C01 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR370853 RBd27C05 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR370897 RBd27E01 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR375209 RBd38A09 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR379210 RBd48A10 pGCAP10 NM_001032.3  
GATTCTGGGTAAACTGTCTCAAAAATTTGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTT
HKR380525 RBd51F05 pGCAP10 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR380811 RBd52A11 pGCAP10 NM_001032.3  
AGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR382883 RBd57D11 pGCAP10 NM_001032.3  
GATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTCGNNCAGGGTTCTCGCTC
HKR383228 RBd58B04 pGCAP10 NM_001032.3  
GCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGA
HKR384502 RBd61E06 pGCAP10 NM_001032.3  
GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
HKR385380 RBd63H12 pGCAP10 NM_001032.3  
GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR385625 RBd64B01 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR385682 RBd64D10 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR386127 RBd65F07 pGCAP10 NM_001032.3  
GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR386480 RBd66D08 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR388859 RBd72C11 pGCAP10 NM_001032.3  
GTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
HKR389703 RBd74E07 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR390098 RBd75E02 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR390807 RBd77A07 pGCAP10 NM_001032.3  
TGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR394082 RBd85D10 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR395626 RBd89B02 pGCAP10 NM_001032.3  
GGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCACCCGCGAAAATTC
HKR397777 RBd94H09 pGCAP10 NM_001032.3  
GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
HKR398174 RBd95H06 pGCAP10 NM_001032.3  
GCTTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR399301 RBd98E05 pGCAP10 NM_001032.3  
GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR402929 RBdS007F09 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR406067 RBdS015C19 pGCAP10 NM_001032.3  
TGCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR406280 RBdS015L16 pGCAP10 NM_001032.3  
GGAAGAGCGCATGCGTGGGCCAGCTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAG
HKR408907 RBdS022E11 pGCAP10 NM_001032.3  
GCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGA
HKR416028 RBdS040B04 pGCAP10 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR420758 RBdS051O22 pGCAP10 NM_001032.3  
CGGCCGGCCGATTATGCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGC
HKR428025 RBdS070B01 pGCAP10 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR428115 RBdS070E19 pGCAP10 NM_001032.3  
GTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG
HKR428274 RBdS070L10 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR430130 RBdS075F10 pGCAP10 NM_001032.3  
CTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCAC
HKR441944 RBdS104O08 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR461784 RBdS154H16 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR461836 RBdS154J20 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR462455 RBdS156C07 pGCAP10 NM_001032.3  
GCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCC
HKR474901 RBdS187E05 pGCAP10 NM_001032.3  
GCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTGGAGCCA
HKR475053 RBdS187K13 pGCAP10 NM_001032.3  
GTTCTTCCTTTTACCTCGTTGCACTGCTGAGAGCAAGATGGGTCACCAGCAGCTGTACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl