Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00535

HP ID(1) HP00535
Gene ID(2) 5931
Gene Symbol finder RBBP7
Protein Name retinoblastoma binding protein 7?
RefSeq NM_002893.3
Length of RefSeq (bp) 2021
Chromosome Xp22.2
Reference DDBJ accession
UniGene Hs.495755

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe81G10 pKA1U5 GGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGAGAGAGAAGAGCG
ARe92B04 pKA1U5 GGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGAGAGAGAAGAGCG
ARi44G02 pGCAP10 GGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGAGAGAGAAGAGCGCCTCAGACCTCG
ARiS150I22 pGCAP10 GGAGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGAGGAGGCAGGAAAGAAG
RBd07H08 pGCAP10 GAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGA
RBd69A01 pGCAP10 GACTTTTCCCAGGGCGGATGCGCCTGCGCTCAGCTGCCTGGGCGGGCTGGGAGGCGCGGG
RBdS051A05 pGCAP10 GGCGCTCAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTG
RBdS051B07 pGCAP10 GGTTCCAAGTTTGGAGAGAGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGA
RBdS051H15 pGCAP10 GGTTCCAAGTTTGGAGAGAGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGA
RBdS070I19 pGCAP10 NNAGCTANCTGGNNNNNCTGGNAGGCGCGGGTTGAAAANTCTCGTTCCAAGTTTGGAGAG
RBdS083G11 pGCAP10 GAGACCCGCCTCTCCGCCTCCTCTCACTTTTCCCAGGGCGGATGCGCCTGCGCTCAGCTG
RBdS105H14 pGCAP10 GAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGA
RBdS177F05 pGCAP10 GCCCNNCCCGNCCNCGGNNNNNAGGGNNNNNNNNNANNNNCANNNCNNNGTTNTGGAAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl